EHP Library Malaria Bulletin, Feb 14-22, 2001

In the News

Website for the Third MIM Pan-African Malaria Conference at: http://mim.nih.gov

WHO/TDR: The transformation of a malaria mosquito
Scientists successfully insert a functional gene into mosquitos

WHO/TDR: An artesunate + sulphadoxine/pyrimethamine combination blister package being developed jointly

TDR, MSF and IDA working together to develop a blister package of artesunate and sulphadoxine/pyrimethamine for malaria treatment

WHO/TDR: Do insecticide-treated materials merely delay childhood mortality? 
Results just in from one of the first studies to address the existence of delayed mortality from use of insecticide-treated materials

Social Sciences and Malaria

Improving Community Case Management of Childhood Malaria: How Behavioral Research Can Help. USAID SARA Project, October 1999.
Copies can be requested at [email protected]
Annals of Tropical Medicine and Parasitology 2000, 94/8 (771-778)

Incidence and management of malaria in two communities of different socio-economic level, in Accra, Ghana
Biritwum R.B.; Welbeck J.; Barnish G.
R.B. Biritwum, Department of Community Health, Ghana Medical School, P.O.
Box 4236, Accra Ghana
Email: [email protected]

Two adjacent communities of differing socio-economic levels were selected, in Accra, Ghana, for the study of the home management of malaria. The youngest child in each selected household, each of which had a child aged < 5 years, was recruited for weekly follow-up, following informed consent. Malaria was the most common condition reported by the ‘caregivers’ (mothers of the subjects and others caring for the subjects) in each community, with 2.0 episodes of clinical malaria/child during the 9-month study. Most (89%) of the caregivers in the better-off community had been educated beyond primary-school level, but 55% of the caregivers in the
poorer community had either received no formal education or only primary-school education. This difference was also reflected by the educational facilities provided to the children studied: 52% of the those in the better-off community attended nurseries, kindergartens or creches, compared with 8% of the children investigated in the poorer community. The proportion of caregivers who purchased drugs without prescription or used
left-over drugs to treat clinical malaria in the children was higher in the poorer community (82% v. 53%), and a child from the poorer community was less likely to have been taken to a clinic or hospital to be treated for malaria than a child from the better-off community (27% v. 42%). During the follow-up period two children died, one from each community. Treatment of
malaria in young children is likely to be less effective in the poorer community, where a lack of economic access to health services was demonstrated. 

Lancet: 13 JAN 2001, 357/9250 (106-110)

Quality of hospital care for seriously ill children in less-developed countries
Nolan T.; Angos P.; Cunha A.J.L.A.; Muhe L.; Qazi S.; Simoes E.A.F.; Tamburlini G.; Weber M.; Pierce N.F.
Prof. N.F. Pierce, Department of International Health, Johns Hopkins University, School of Hygiene and Public Health, Baltimore, MD 21205 United States
Email: [email protected]

Background: Improving the quality of care for sick children referred to hospitals in less-developed countries may lead to better outcomes, including reduced mortality. Data are lacking, however, on the quality of priority screening (triage), emergency care, diagnosis, and inpatient treatment in these hospitals, and on aspects of these potential targets that would benefit most from interventions leading to improved health outcomes. Methods: We did a qualitative study in 13 district hospitals and
eight teaching hospitals in seven less-developed countries. Experienced paediatricians used a structured survey instrument to assess initial triage, emergency and inpatient care, staff knowledge and practices, and hospital support services. Findings: Overall quality of care differed between countries and among hospitals and was generally better in teaching hospitals, 14 of 21 hospitals lacked an adequate system for triage. Initial patient assessment was often inadequate and treatment delayed. Most emergency treatment areas were poorly organised and lacked essential supplies: families were routinely required to buy emergency drugs before they could be given. Adverse factors in case management, including inadequate assessment, inappropriate treatment, and inadequate monitoring occurred in 76% of inpatient children. Most doctors in district hospitals, and nurses and medical assistants in teaching and district hospitals, had inadequate knowledge and reported practice for managing important childhood illnesses. Interpretation: Strengthening care for sick children referred to
hospital should focus on achievable objectives with the greatest potential benefit for health outcome. Possible targets for improvement include initial triage, emergency care, assessment, inpatient treatment, and monitoring. Priority targets for individual hospitals may be determined by
assessing each hospital. 

PubMed, Feb 14 – February 22, 2001

J Travel Med 2000 Jan;8(1):19-25

Changing Epidemiological and Clinical Aspects of Imported Malaria in Belgium.
Van Den Ende J, Morales I, Van Den Abbeele K, Clerinx J, Colebunders R, Kager P, Lynen L, Van Gompel A, Van Der Planken M, Vervoort T

Institute of Tropical Medicine, Belgium. (I.T.M.A.), and University Hospital Antwerp, Belgium.

BACKGROUND: In the early nineties the increase of imported malaria in some European countries was temporarily halted, but it resumed in 1994. More Africans, more European travelers, and fewer long-term residents were counted amongst patients. A shift towards more subacute disease has been noted. This study intends to assess whether the same trends were observed in Belgium. METHODS: Clinical and epidemiological data of 128 patients treated for malaria in 1997 at the Institute of Tropical Medicine and the University Hospital of Antwerp were compared with 209 malaria patients treated in 1988/1989. Risk factors for clinical presentation and parasitemia were analysed. RESULTS: In Belgium the number of reported imported malaria cases remained almost stable between 1988 and 1997. In 1997, there were more African patients, less infections from Central Africa, and 50% less residents. Less patients reported prophylaxis use. The causative agent shifted from Plasmodium falciparum to other species. Subacute and atypical malaria became less frequent. In both years, there were no deaths, and severe malaria did not increase significantly. Mefloquine disappeared almost as a curative treatment, and was replaced by quinine, with or without a long acting agent, or by halofantrine. The ethnic origin, nor the use of chemoprophylaxis, influenced disease characteristics. In 1988, malaria attacks in the previous months predisposed to subacute disease; longer residence, and attacks in the previous months, protected against high parasitemia; longer symptom duration correlated with absence of fever, and with splenomegaly. None of these risk factors was correlated with severe malaria. CONCLUSION: The incidence of subacute malaria dropped significantly in the last decade. Although this presentation is almost limited to residents, the decline in malaria can not be explained by an overall shorter duration of stay, since the decline in this particular clinical presentation of malaria was also spectacular in residents. Apparently, insufficient treatment of malaria attacks in the previous months is the only independent risk factor.

Antimicrob Agents Chemother 2001 Mar;45(3):932-935

Controlled Trial of 3-Day Quinine-Clindamycin Treatment versus 7-Day Quinine Treatment for Adult Travelers with Uncomplicated Falciparum Malaria Imported from the Tropics.
Parola P, Ranque S, Badiaga S, Niang M, Blin O, Charbit JJ, Delmont J, Brouqui P

Service des Maladies Tropicales et Infectieuses, France.

We conducted a randomized, double-blind, placebo-controlled trial to compare a 3-day quinine-clindamycin regimen (group QC) with a 7-day quinine regimen (group Q) for the treatment of uncomplicated Plasmodium falciparum malaria in travelers returning from the tropics. A total of 55 and 53 patients in groups Q and QC were analyzed, respectively. Adverse effects were similar in both groups, although two patients in group Q had severe adverse reactions, leading to the cessation of treatment. The 28-day cure rate for the evaluated patients (per-protocol analysis) was 100% for group QC, whereas it was 96.3% for group Q (P = 0.5). The 28-day cure rate in the intention-to-treat analysis was 96.2% for group QC, whereas it was 94.6% for group Q (P = 1). There were no significant differences between the two regimens with regard to parasite and fever clearance times. Our study shows that the 3-day quinine-clindamycin regimen is well tolerated and compares favorably with a 7-day quinine treatment. This short-term regimen had previously been evaluated only in areas of endemicity. According to our results, the 3-day quinine-clindamycin regimen may be an alternative for the treatment of imported uncomplicated P. falciparum malaria in travelers returning from the tropics.

J Infect Dis 2001 Jan;183(5):796-804

Frequent and Persistent, Asymptomatic Plasmodium falciparum Infections in African Infants, Characterized by Multilocus Genotyping.
Franks S, Koram KA, Wagner GE, Tetteh K, McGuinness D, Wheeler JG, Nkrumah F, Ranford-Cartwright L, Riley EM

Institute of Cell, Animal, and Population Biology, Division of Biological Sciences, University of Edinburgh, Edinburgh, United Kingdom.

To determine the duration and complexity of naturally acquired Plasmodium falciparum infections in small children, a longitudinal cohort study of 143 newborns was conducted in coastal Ghana. On average, children experienced 2 episodes of infection in their first 2 years of life, the median duration of an asymptomatic infection was <4 weeks, and estimates of the mean number of parasite genotypes per infection were 1.15-2.28. Nevertheless, 40% of the children experienced infections lasting </=12 weeks, and both the duration and complexity of infections increased with age. The longest period of continual infection was 64 weeks, and the maximum persistence of a single parasite genotype was 40 weeks. Thus, malaria infections in infants <5 months old tend to be asymptomatic and rapidly cleared; persistent asymptomatic parasitemia is more common in children >5 months old. The ability of very young children to clear or control malaria infections indicates the presence of effective innate or immune antiparasite mechanisms.

J Infect Dis 2001 Jan;183(5):789-795

Plasmodium falciparum Malaria in Laos: Chloroquine Treatment Outcome and Predictive Value of Molecular Markers.
Pillai DR, Labbe AC, Vanisaveth V, Hongvangthong B, Pomphida S, Inkathone S, Zhong K, Kain KC

Centre for Travel and Tropical Medicine, Division of Infectious Diseases, Department of Medicine, and Institute of Medical Science, Toronto General Hospital and University of Toronto, Toronto, Canada.

A 28-day treatment trial was undertaken, to determine the efficacy of chloroquine in Laos and to assess the predictive value of molecular markers (cg2, pfmdr1, and pfcrt) that were previously linked to chloroquine resistance. In total, 522 febrile patients were screened for falciparum malaria by rapid diagnostic assays. Of 81 patients (15.5% prevalence) who were positive by the assays and microscopy, 48 were eligible to participate in the 28-day trial. Nine patients defaulted. Chloroquine cured 54% (95% confidence interval, 45.8-61.8) of falciparum-infected patients. Of 18 (46%) patients with treatment failure, 13 (72%) experienced high-grade resistance. Polymorphisms in cg2 and the N86Y mutation in PfMDR1 were not predictive of treatment outcome. A mutation in PfCRT (K76T) was perfectly associated with in vivo chloroquine resistance. However, K76T was also present in in vivo-sensitive isolates, which suggests that the presence of this mutation was necessary, but not sufficient, to predict in vivo outcome in this cohort.

Phytother Res 2001 Feb;15(1):30-33

Biological activities of the plant-derived bisindole voacamine with reference to malaria.
Ramanitrahasimbola D, Rasoanaivo P, Ratsimamanga-Urverg S, Federici E, Palazzino G, Galeffi C, Nicoletti M

Laboratoire de Phytochimie et de Pharmacologie Cellulaire et Parasitaire, Institut Malgache de Recherches Appliquees, B. P. 3833, 101-Antananarivo, Madagascar.

The in vivo antiplasmodial activity of voacamine was assessed in a 4-day test. It was shown to exhibit in vivo activity with 25.4% and 43.4% inhibition of parasitaemia with 2.5 and 10 mg/kg, respectively. In synchronized cultures, it was found to act on trophozoite and schizont stages of Plasmodium falciparum. Using the FMC29 strain of Plasmodium falciparum as parasite and the isobologram curve as a method to assess interaction in drug combination, it was shown to lack any chloroquine-enhancing activity and its in vitro antiplasmodial effect was not potentiated by the chemosensitizer malagashanine. Copyright -Copyright 2001 John Wiley & Sons, Ltd.

Phytother Res 2001 Feb;15(1):1-17

A review of plant species assessedin vitro for antiamoebic activity or both antiamoebic and antiplasmodial properties.
Sharma P, Sharma JD

Medicinal Ecology, Environmental and Occupational Health, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi 110067, India.

The resurgence of the protozoal diseases amoebiasis and malaria has been known to occur, from time to time, in endemic and epidemic proportions all over the world. Furthermore, the import of these individual pathogens to other areas from tropical regions encourages these protozoal diseases to occur on a global scale with considerable associated mortality and morbidity. From time immemorial, the cure of these diseases has been attempted with the use of traditional plant products, derived from such species as are available within local habitats and ecosystems, and dependent on their host community for their conservation. Scientific validation and in vitro investigation, continues to be an important requirement for drug development, particularly with the emergence of resistance and cross resistance to some standard drugs used in such protozoal diseases. This paper provides a comparative compilation of the various studies reported between 1982 and 1999, on plants with antiamoebic activities and those which possess both antiamoebic and antiplasmodial activities. The results suggest that it is advisable to increase efforts towards the conservation of such plants, in order to retain their economic and therapeutic significance. Copyright 2001 John Wiley & Sons, Ltd.

Eur J Immunol 2001 Feb;31(2):539-550

Fixed, epitope-specific, cytophilic antibody response to the polymorphic block 2 domain of the Plasmodium falciparum merozoite surface antigen MSP-1 in humans living in a malaria-endemic area.
Jouin H, Rogier C, Trape JF, Mercereau-Puijalon O

Unite d’Immunologie Moleculaire des Parasites, CNRS URA 1960, Institut Pasteur, Paris, France.

The MSP-1 merozoite surface antigen of the human malaria parasite Plasmodium falciparum is a major target of immune response. The domain called block 2 shows extensive allelic diversity, with more than 50 alleles identified, grouped into three allelic families. Presence of anti-block 2 antibodies has been associated with reduced risk for clinical malaria, but whether or not allele-specific antibodies are implicated remains unclear. To study the fine specificity of the human antibody response, we have used a series of 82 overlapping, N-biotinylated, 15-mer peptides scanning reference alleles and including numerous sequence variants. Peptide antigenicity was validated using sera from mice immunized with recombinant proteins. A cross-sectional survey conducted in a Senegalese village with intense malaria transmission indicated an overall 56 % seroprevalence. The response was specific for individuals and unrelated to the HLA type. Each responder reacted to a few peptides, unrelated to the infecting parasite genotype(s). Seroprevalence of each individual peptide was low, with no identifiable immunodominant epitope. Anti-block 2 antibodies were mostly of the IgG3 isotype, consistent with an involvement in cytophilic antibody-mediated merozoite clearance. The number of responders increased with age, but there was no accumulation of novel specificities with age and hence with exposure to an increasingly large number of alleles. A 15-month longitudinal follow up outlined a remarkably fixed response, with identical reactivity profiles, independent of the past or current parasite types, a pattern reminiscent of clonal imprinting. The implications of the characteristics of the anti-block 2 antibody response in parasite clearance are discussed.

Infect Immun 2001 Mar;69(3):1643-1649

Interleukin-12- and Gamma Interferon-Dependent Protection against Malaria Conferred by CpG Oligodeoxynucleotide in Mice.
Gramzinski RA, Doolan DL, Sedegah M, Davis HL, Krieg AM, Hoffman SL

Malaria Program, Naval Medical Research Center, Silver Spring, Maryland 20910-7500.

Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-gamma) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-gamma. Moreover, CD8(+) T cells (but not CD4(+) T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8(+) T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria.

Curr Infect Dis Rep 2001 Feb;3(1):68-

Recent Advances in the Prophylaxis and Treatment of Malaria.
Labbe AC, Loutfy MR, Kain KC

Department of Medicine, Tropical Disease Unit, University Health Network, University of Toronto, 200 Elizabeth Street, EN G 224, Toronto, ON, Canada, M5G 2C4. Email: [email protected]

Increases in international travel and escalating drug resistance are putting put a growing number of travelers at risk of contracting malaria. Resistance to chloroquine and proguanil and real and perceived intolerance to standard agents, such as mefloquine, has highlighted the need for new antimalarials to prevent and treat malaria. Promising new agents to prevent malaria include the combination of atovaquone and proguanil, primaquine, and a related 8-aminoquinoline, tafenoquine. These agents are active against the liver stage of the malaria parasite, and therefore can be discontinued shortly after the traveler leaves the malaria-endemic area; this offers a clear advantage, in terms of adherence to a treatment regimen. For treatment of multidrug-resistant Plasmodium falciparum malaria, the combination of artemisinin derivatives plus mefloquine, or atovaquone plus proguanil, are the most active drug regimens.

Nat Med 2001 Feb;7(2):167-173

Triclosan offers protection against blood stages of malaria by inhibiting enoyl-ACP reductase of Plasmodium falciparum.
Surolia N, Surolia A

Molecular Biology and Genetics Unit, Jawaharlal Nehru Centre for Advanced Scientific Research, Jakkur, Bangalore, India.

The antimicrobial biocide triclosan [5-chloro-2-(2,4-dichlorophenoxy)phenol] potently inhibits the growth of Plasmodium falciparum in vitro and, in a mouse model, Plasmodium berghei in vivo. Inhibition of [14C]acetate and [14C]malonyl-CoA incorporation into fatty acids in vivo and in vitro, respectively, by triclosan implicate FabI as its target. Here we demonstrate that the enoyl-ACP reductase purified from P. falciparum is triclosan sensitive. Also, we present the evidence for the existence of FabI gene in P. falciparum. We establish the existence of the de novo fatty acid biosynthetic pathway in this parasite, and identify a key enzyme of this pathway for the development of new antimalarials.

Cad Saude Publica 2000 Dec;16(4):1127-1131

Malaria in Sucre State, Venezuela.
Zimmerman RH

Florida Medical Entomology Laboratory, Institute of Food and Agricultural Sciences, University of Florida, Vero Beach, FL, 32962, U.S.A.

The author reviews the malaria research program in Sucre State, Venezuela, taking an ecosystem approach. The goal was to determine which methods could have been introduced at the onset that would have made the study more ecological and interdisciplinary. Neither an ecosystem approach nor integrated disease control were in place at the time of the study. This study began to introduce an ecosystem approach when two contrasting ecosystems in Sucre State were selected for study and vector control methods were implemented based on research results. The need to have a health policy in place with an eco-health approach is crucial to the success of research and control. The review suggests that sustainability is low when not all the stakeholders are involved in the design and implementation of the research and control strategy development. The lack of community involvement makes sustainability doubtful. The author concludes that there were two interdependent challenges for malaria control: development of an ecosystem approach for malaria research and control, and the implementation of an integrated disease control strategy, with malaria as one of the important health issues.

Curr Med Chem 2001 Feb 1;8(2):171-189

Heme Aggregation Inhibitors: Antimalarial Drugs Targeting an Essential Biomineralization Process.
Wright DW, Ziegler J, Linck R

Department of Chemistry and Biochemistry, Duquesne University, Pittsburgh, PA 15282-1530, USA.

Malaria, resulting from the parasites of the genus Plasmodium, places an untold burden on the global population. As recently as 40 years ago, only 10% of the world’s population was at risk from malaria. Today, over 40% of the world?s population is at risk. Due to increased parasite resistance to traditional drugs and vector resistance to insecticides, malaria is once again resurgent. An emergent theme from current strategies for the development of new antimalarials is that metal homeostasis within the parasite represents an important drug target. During the intra-erythrocytic phase of its life cycle, the malaria parasite can degrade up to 75% of an infected cell?s hemoglobin. While hemoglobin proteolysis yields requisite amino acids, it also releases toxic free heme (Fe(III)PPIX). To balance the metabolic requirements for amino acids against the toxic effects of heme, malaria parasites have evolved a detoxification mechanism which involves the formation of a crystalline heme aggregate known as hemozoin. An overview of the biochemistry of the critical detoxification process will place it in the appropriate context with regards to drug targeting and design. Quinoline-ring antimalarial drugs are effective against the intraerythrocytic stages of pigment-producing parasites. Recent work on the mechanism of these compounds suggests that they prevent the formation of hemozoin. Evidence for such a mechanism is reviewed, especially in the context of the newly reported crystal structure of hemozoin. Additionally, novel drugs, such as the hydroxyxanthones, which have many of the characteristics of the quinolines are currently being investigated. Recent work has also highlighted two classes of inorganic complexes that have interesting antimalarial activity: (1) metal-N4O2 Schiff base complexes and (2) porphyrins. The mechanism of action for these complexes is discussed. The use of these complexes as probes for the elucidation of structure-activity relationships in heme polymerization inhibitor design and the loci of drug resistance is also detailed. As the biochemistry of the complicated interactions between host, parasite, and vector become better understood, the rationale for new antimalarial drug treatments will continue to improve. Clearly, the homeostasis of metal ions is a complicated biochemical process and is not completely understood. For the immediate future, it does, however, provide a clear target for the development of new and improved treatments for malaria.

N Engl J Med 2001 Jan 25;344(4):257-263

A Molecular Marker for Chloroquine-Resistant Falciparum Malaria.
Djimde A, Doumbo OK, Cortese JF, Kayentao K, Doumbo S, Diourte Y, Dicko A, Su X, Nomura T, Fidock DA, Wellems TE, Plowe CV, Coulibaly D

Malaria Section, Center for Vaccine Development, University of Maryland School of Medicine, 685 W. Baltimore St., HSF 480, Baltimore, MD 21201, or at email: [email protected]
Yacouba Diourte, Pharm.D., is deceased.

Background: Chloroquine-resistant Plasmodium falciparum malaria is a major health problem, particularly in sub-Saharan Africa. Chloroquine resistance has been associated in vitro with point mutations in two genes, pfcrt and pfmdr 1, which encode the P. falciparum digestive-vacuole transmembrane proteins PfCRT and Pgh1, respectively. Methods: To assess the value of these mutations as markers for clinical chloroquine resistance, we measured the association between the mutations and the response to chloroquine treatment in patients with uncomplicated falciparum malaria in Mali. The frequencies of the mutations in patients before and after treatment were compared for evidence of selection of resistance factors as a result of exposure to chloroquine. Results: The pfcrt mutation resulting in the substitution of threonine (T76) for lysine at position 76 was present in all 60 samples from patients with chloroquine-resistant infections (those that persisted or recurred after treatment), as compared with a base-line prevalence of 41 percent in samples obtained before treatment from 116 randomly selected patients (P<0.001), indicating absolute selection for this mutation. The pfmdr 1 mutation resulting in the substitution of tyrosine (Y86) for asparagine at position 86 was also selected for, since it was present in 48 of 56 post-treatment samples from patients with chloroquine-resistant infections (86 percent), as compared with a base-line prevalence of 50 percent in 115 samples obtained before treatment (P<0.001). The presence of pfcrt T76 was more strongly associated with the development of chloroquine resistance (odds ratio, 18.8; 95 percent confidence interval, 6.5 to 58.3) than was the presence of pfmdr 1 Y86 (odds ratio, 3.2; 95 percent confidence interval, 1.5 to 6.8) or the presence of both mutations (odds ratio, 9.8; 95 percent confidence interval, 4.4 to 22.1). Conclusions: This study shows an association between the pfcrt T76 mutation in P. falciparum and the development of chloroquine resistance during the treatment of malaria. This mutation can be used as a marker in surveillance for chloroquine-resistant falciparum malaria.

Proc Natl Acad Sci U S A 2001 Feb 13;98(4):1805-1810

Platelet-mediated clumping of Plasmodium falciparum-infected erythrocytes is a common adhesive phenotype and is associated with severe malaria.
Pain A, Ferguson DJ, Kai O, Urban BC, Lowe B, Marsh K, Roberts DJ

Nuffield Department of Clinical Laboratory Sciences and National Blood Service, John Radcliffe Hospital, Oxford OX3 9DU, United Kindgom; and Kenyan Medical Research Institute, P.O. Box 230, Kilifi, Kenya.

(full-text at: http://www.pnas.org)

Sequestration of malaria-infected erythrocytes in the peripheral circulation has been associated with the virulence of Plasmodium falciparum. Defining the adhesive phenotypes of infected erythrocytes may therefore help us to understand how severe disease is caused and how to prevent or treat it. We have previously shown that malaria-infected erythrocytes may form apparent autoagglutinates of infected erythrocytes. Here we show that such autoagglutination of a laboratory line of P. falciparum is mediated by platelets and that the formation of clumps of infected erythrocytes and platelets requires expression of the platelet surface glycoprotein CD36. Platelet-dependent clumping is a distinct adhesive phenotype, expressed by some but not all CD36-binding parasite lines, and is common in field isolates of P. falciparum. Finally, we have established that platelet-mediated clumping is strongly associated with severe malaria. Precise definition of the molecular basis of this intriguing adhesive phenotype may help to elucidate the complex pathophysiology of malaria.

Proc Natl Acad Sci U S A 2001 Feb 13;98(4):1699-1704

Eight novel families of miniature inverted repeat transposable elements in the African malaria mosquito, Anopheles gambiae.
Tu Z

Department of Biochemistry, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061.

(full-text at http://www.pnas.org)

Eight novel families of miniature inverted repeat transposable elements (MITEs) were discovered in the African malaria mosquito, Anopheles gambiae, by using new software designed to rapidly identify MITE-like sequences based on their structural characteristics. Divergent subfamilies have been found in two families. Past mobility was demonstrated by evidence of MITE insertions that resulted in the duplication of specific TA, TAA, or 8-bp targets. Some of these MITEs share the same target duplications and similar terminal sequences with MITEs and other DNA transposons in human and other organisms. MITEs in A. gambiae range from 40 to 1340 copies per genome, much less abundant than MITEs in the yellow fever mosquito, Aedes aegypti. Statistical analyses suggest that most A. gambiae MITEs are in highly AT-rich regions, many of which are closely associated with each other. The analyses of these novel MITEs underscored interesting questions regarding their diversity, origin, evolution, and relationships to the host genomes. The discovery of diverse families of MITEs in A. gambiae has important practical implications in light of current efforts to control malaria by replacing vector mosquitoes with genetically modified refractory mosquitoes. Finally, the systematic approach to rapidly identify novel MITEs should have broad applications for the analysis of the ever-growing sequence databases of a wide range of organisms.

Biochem Soc Trans 2000 Dec 1;28(6):785-789

Non-mevalonate isoprenoid biosynthesis: enzymes, genes and inhibitors.
Lichtenthaler HK

Botanical Institute II, University of Karlsruhe, Kaiserstr. 12, D-76128 Karlsruhe, Germany.

The essential steps of the novel non-mevalonate pathway of isopentenyl diphosphate and isoprenoid biosynthesis in plants are described. The first five enzymes and genes of this 1-deoxy-D-xylulose 5-phosphate/2-C-methyl-D-erythritol 4-phosphate (DOXP/MEP) pathway are known. The herbicide fosmidomycin specifically blocks the second enzyme, the DOXP reductoisomerase. The DOXP/MEP pathway is also present in several pathogenic bacteria and the malaria parasite. Hence, all herbicides and inhibitors blocking this novel isoprenoid pathway in plants are also potential drugs against malaria and diseases caused by pathogenic bacteria.

J Infect Dis 2001 Jan;183(4):640-647

Efficacy of Recombinant Circumsporozoite Protein Vaccine Regimens against Experimental Plasmodium falciparum Malaria.
Kester KE, McKinney DA, Tornieporth N, Ockenhouse CF, Heppner DG, Hall T, Krzych U, Delchambre M, Voss G, Dowler MG, Palensky J, Wittes J, Cohen J, Ballou WR

Dept. of Immunology, Walter Reed Army Institute of Research, Silver Spring, MD 20910, USA. Email: [email protected]

After initial successful evaluation of the circumsporozoite-based vaccine RTS,S/SBAS2, developed by SmithKline Beecham Biologicals with the Walter Reed Army Institute of Research, protective efficacy of several regimens against Plasmodium falciparum challenge was determined. A controlled phase 1/2a study evaluated 1 or 2 standard doses of RTS,S/SBAS2 in 2 groups whose members received open-label therapy and 3 immunizations in blinded groups who received standard, one-half, or one-fifth doses. RTS,S/SBAS2 was safe and immunogenic in all groups. Of the 41 vaccinees and 23 control subjects who underwent sporozoite challenge, malaria developed in 7 of 10 who received 1 dose, in 7 of 14 who received 2 doses, in 3 of 6 who received 3 standard doses, in 3 of 7 who received 3 one-half doses, in 3 of 4 who received 3 one-fifth doses, and in 22 of 23 control subjects. Overall protective efficacy of RTS,S/SBAS2 was 41% (95% confidence interval, 22%-56%; P=.0006). This and previous studies have shown that 2 or 3 doses of RTS,S/SBAS2 protect against challenge with P. falciparum sporozoites.

J Hosp Infect 2001 Feb;47(2):156-158

Hospital-acquired malaria transmitted by contaminated gloves.
Piro S, Sammud M, Badi S, Al Ssabi L

Infectious Diseases Division, Tripoli Central Hospital, Tripoli, Libya

We describe two cases of malaria occurring in a malaria-free zone in two in-patients, two weeks after a case of Plasmodium falciparum malaria, acquired in Burkina Faso, had been admitted to the same ward. After reviewing the techniques used by nursing staff, we conclude that transmission probably occurred via gloves contaminated following manipulation of venous cannulae and drip lines of the patient with Burkina Faso-acquired malaria and which had not been discarded before manipulating the intravenous lines of the other two patients. Nosocomial transmission of unusual and potentially life-threatening infections should be taken into consideration in those settings where compliance with universal precautions is not rigorous. Copyright 2001 The Hospital Infection Society.